Simultaneous detection of pork and wild boar meat in chicken sausages using the combination of a single primer and real-time polymerase chain reaction (qPCR)

Authors

  • Nurull Hikmah Department of Pharmaceutical Chemistry, Gadjah Mada University,Yogyakarta, Indonesia http://orcid.org/0000-0003-2731-8687
  • Rumiyati Rumiyati Department of Pharmaceutical Chemistry, Gadjah Mada University,Yogyakarta, Indonesia
  • Sismindari Sismindari Department of Pharmaceutical Chemistry, Gadjah Mada University,Yogyakarta, Indonesia
  • Abdul Rohman Department of Pharmaceutical Chemistry, Gadjah Mada University,Yogyakarta, Indonesia Institute of Halal Industry and Systems (IHIS), Gadjah Mada University, Yogyakarta, Indonesia

DOI:

https://doi.org/10.12928/pharmaciana.v10i1.14771

Keywords:

Real-time PCR, non-halal meat, halal authentication, species-specific primer

Abstract

The identification of meat species in food products and pharmaceuticals is vital to minimize food adulteration practices. Due to its specificity, polymerase chain reaction (PCR)-based methods are the most commonly reported methods for detection of food adulterants. This study was aimed to evaluate the use of real-time PCR with a species-specific primer to identify two non-halal types of meat, namely pork and wild boar meat (WBM), in chicken sausages. The primer was designed using online software PrimerQuest from NCBI (National Center for Biotechnology Information) to target the mitochondrial ND1 gene of Sus scrofa domestica. The annealing temperature (Ta) of the primer used during real-time PCR analysis was optimized to achieve the highest response fluorescence unit at the lowest cycles. Real-time PCR using the primers of NK-ND1-Ssc1 (Forward: 5’ AAAGGACCCAACGTTGTAGG 3’ and Reverse: 5’ TAGTGCTAGGGATAAGGCTAGG 3’) was validated with several parameters, namely specificity, the limit of detection for sensitivity, linearity, efficiency, and repeatability. The optimum annealing temperature of NK-ND1-Ssc1 was 58.1oC. The sensitivity evaluation revealed that the limits of detection (LoD) of pork and WBM in reference sausage samples containing 100% pork and WBM were 500 pg and 50 pg, respectively, which correspond to 0.3% meat in sausage products. The efficiency values of real-time PCR amplification were 93.1% and 94.8% for pork and WBM with coefficient variations of 0.2884% and 0.4998%, respectively. The validated method was subsequently applied to analyze the commercial samples, and among the twelve (12) samples evaluated, there was one sample positive of containing non-halal meat (pork or WBM). Real-time PCR using species-specific primers, e.g., NK-ND1-Ssc1, is specific and sensitive; therefore, this method can be used as an alternative technique for authentication of halal meat.

References

Aina, G. Q., Erwanto E., Hossain, M., Johan, M. R., Ali, M. E. and Rohman, A., 2019, The employment of qPCR using Specific Primer Targeting on Mitochondrial cytochrome-b Gene for Identification of Wild boar Meat in Meatball Samples, Journal of Advanced Veterinary and Animal Research, 6(3): 300-307.

Alamprese, C., Casale, M., Sinelli, N., Lanteri, S. and Casiraghi, E., 2013, Detection of Minced Beef adulteration with Turkey Meat by UV–vis, NIR and MIR spectroscopy, LWT – Food Science and Technology, 53: 225–232.

Ali, M. E., Rahman, M. M., Hamid, S. B. A., Mustafa, S., Bhassu, S., Hashim, U., 2013, Canine-specific PCR Assay Targeting cytochrome b Gene for The Detection of Dog Meat Adulteration in Commercial Frankfurters, Food Analytical Methods, 7: 234–241.

Ali, M. E., Amin, M., Razzak, M. A., Hamid, S. B. A., Rahman, M. M. and Rashid, N. R. A., Asing, A., 2015, Short Amplicon-Length PCR Assay Targeting Mitochondrial Cytochrome b Gene for the Detection of Feline Meats in Burger Formulation, Food Analytical Methods, 9(3): 571–581.

Ali, M. E., Ahamad, M. N. U., Asing, A., Hossain, M. A. M. and Sharmin, S., 2018, Multiplex Polymerase Chain Reaction-Restriction Fragment length Polymorphism Assay Discriminates of Rabbit, Rat and Squirrel Meat in Frankfurter Products, Food Control, 84: 148-158.

Asensio, L., González, I., García, T. and Martín, R., 2008, Determination of Food Authenticity by Enzyme-Linked Immunosorbent Assay (ELISA), Food Control, 19: 1–8.

Bio-Rad, 2006, Real-Time PCR Application Guide, USA: Bio-Rad Laboratories, Inc.

Chou, C. C., Li, S. P., Lee, K. M., Hsu, C. T., Vickroy, T. W. and Zen, J. M., 2007, Fast Differentiation of Meats from Fifteen Animal Species by Liquid Chromatography with Electrochemical Detection using Copper Nanoparticle Plated Electrodes, Journal of Chromatography B, 846: 230–239.

Codex Alimentarius Commission/GL 74, 2010, Codex Guidelines on Performance Criteria and Validation of Methods for Detection, Identification, and Quantification of Specific DNA Sequences and Specific Proteins In Foods.

Cravero, D., Cerutti, F., Maniaci, M. G., Barzanti, P., Scaramagli, S. M. V. and Riina, A., 2019, Evaluation of DNA Isolation Procedures from Meat-based Foods and Development of a DNA Quality Score, LWT – Food Science and Technology, 106: 64–71.

Hackett, C., Connor, P., Stonawski, M., Skirbekk, V., Potancokova, M. and Abel, G., 2015, The Future of World Religions: Population Growth Projections, 2010-2050, In Stencel S, Lipka M, Sandstrom, A. (Eds.), Washington, DC, Pew Research Center. Overview: 5-23.

Karabasanavar, N. S., Singh, S., Kumar, D. and Shebannavar, S. N., 2014, Detection of Pork Adulteration by Highly-Specific PCR Assay of Mitochondrial D-loop, Food

Chemistry, 145: 530–534.

Lever, J. and Miele, M., 2012, The Growth of Halal Meat Markets in Europe: An Exploration of the Supply-Side Theory of Religion. Journal of Rural Studies, 28: 528-537.

Lubis, H. N., Mohd-Naim, N. F., Alizul, N. N., Ahmed, M. U., 2016, From Market to Food Plate: Current Trusted Technology and Innovations in Halal Food Analysis, Trends in Food Science and Technology, 58: 55-68.

Mafra, I., Silva, S. A., Moreira, E. J. M. O., da Silva C. S. F., Beatriz, M, and Oliveira, P. P., 2008, Comparative study of DNA extraction methods for soybean derived food products. Food Control, 19(12):1183–1190.

Orbayinah S, Rohman A, Widada H, Hermawan A. and Sismindari, 2019, Application of Real-Time Polymerase Chain Reaction using Species-Specific Primer Targeting on Mitochondrial Cytochrome b Gene for Analysis of Pork in Meatball Products. Journal of Advanced Veterinary and Animal Research, 6(2): 260-265.

O'Mahony, P. J., 2013, Finding Horse Meat in Beef Products a Global Problem, QJM, 106: 595–597.

Pang, Z., Deeth, H., Yang, H., Prakash, S. and Bansal, N., 2017, Evaluation of Tilapia Skin Gelatin as a Mammalian Gelatin Replacer in Acid Milk Gels and Low-Fat Stirred Yogurt, Journal of Dairy Science, 100: 3436-3447.

Rahmania, H., Sudjadi, and Rohman, A., 2015, The employment of FTIR spectroscopy in combination with chemometrics for analysis of rat meat in meatball formulation, Meat Science, 100:301–305.

Rao, Q., Richt, J. A. and Hsieh, Y. H. P., 2016, Immunoassay for the Detection of Animal Central Nervous Tissue in Processed Meat and Feed Products. Journal of Agricultural and Food Chemistry, 64: 3661-3668.

Sambrook, J., Fritsch, E. F. and Maniatis, T., 1989, Molecular Cloning: A Laboratory Manual. New York, USA: Cold Spring Harbor Laboratory Press.

Sow, L. C., Peh, Y. R., Pekerti, B. N., Fu, C., Bansal, N. H. and Yang, A., 2017, Nanostructural Analysis and Textural Modification of Tilapia Fish Gelatin Affected by Gellan and Calcium Chloride Addition, LWT-Food Science and Technology, 85: 137-145.

Teletchea, F., Maudet, C. and Ha¨nni, C., 2005, Food and Forensic Molecular Identification: Update and Challenges, Trends in Biotechnology, 23: 359-366.

Widyasari, Y. I., Sudjadi and Rohman, A., 2015, Analysis of Rat Meat in Meatball Formulation using Real-Time Polymerase Chain Reaction, Asian Journal of Animal Science, 9(6): 460-465.

Downloads

Published

2020-03-30

Issue

Vol. 10 No. 1 (2020): Pharmaciana

Section

Analytical Pharmacy and Medicinal Chemistry

License

Authors who publish with Pharmaciana agree to the following terms:

  1. Authors retain copyright and grant the journal the right of first publication with the work simultaneously licensed under a Creative Commons Attribution License (CC BY-SA 4.0) that allows others to share the work with an acknowledgment of the work's authorship and initial publication in this journal. 
  2. Authors are able to enter into separate, additional contractual arrangements for the non-exclusive distribution of the journal's published version of the work (e.g., post it to an institutional repository or publish it in a book), with an acknowledgment of its initial publication in this journal.
  3. Authors are permitted and encouraged to post their work online (e.g., in institutional repositories or on their website) prior to and during the submission process, as it can lead to productive exchanges, as well as earlier and greater citation of published work.