Real-Time PCR-based detection of bovine DNA by specific targeting on cytochrome-B
DOI:
https://doi.org/10.12928/pharmaciana.v9i2.14070Keywords:
primer, Cytochrome-B, bovine DNA, specific, real-time PCRAbstract
The design of specific primers is an interesting research topic such that it offers selective, specific, and effective DNA analysis using real-time PCR. This research was intended to detect bovine DNA using real-time PCR and specific primers to ensure the halal authenticity of food products. Primers of bovine DNA sequences were designed in the NCBI and Primer-BLAST programs. The outcome validation was assessed using several parameters, namely specificity, repeatability, and linearity by real-time PCR. Primer specificity test was performed on fresh tissue (pork and negative control), while the repeatability test used six replications and was based on the calculated coefficient of variation (CV). In the linearity test, six different DNA concentrations (50000, 10000, 5000, 500, 100, and 50 pg/µL) were examined to obtain the efficiency value. Using the specific primer from Cytochrome-B, the real-time PCR could specifically identify the presence of bovine DNA at the optimum annealing temperature of 58.70C. The  repeatability  analysis yielded a coefficient of variation (CV) of 0.57 %, while the linearity test produced an efficiency  value of  206 %. These figures confirm that the method employed  in this study is not only specific but also sensitive and reliable for detecting bovine DNA. Real-time PCR using specific primer targeting on the cytochrome-B region of bovine DNA (forward: CTACTGACACTCACATGAATTGG; reverse CACTAGGATGAGGAGAAAGTATAGG) can be used to identify bovine DNA and distinguish it from porcine DNA.
References
Aida, A.A., Man, Y.B.C., Wong, C.M.V.L., Raha, A.R., and Son, R., 2005, Analysis of raw meats and fats of pigs using polymerase chain reaction for Halal authentication. Meat Science, 69: 47 – 52.
Bio-Rad., 2006. Real-Time PCR Application Guide, Bio-Rad Laboratories, Inc, USA.
Cammà , C., Domenico, M.D., and Monaco, F., 2012, Development and validation of fast Real-Time PCR assays for species identification in raw and cooked meat mixtures. Food Control, 23: 400 – 404.
Clark, D.P., 2005, Nucleic acids: isolation, purification, detection and hybridization, Molecular Biology: Understanding the Genetic Revolution. Elsevier Academic Press, London. 567–598.
Codex Alimentarius Commission, 2010, CAC/GL 74: Codex Guidelines on Performance Criteria and Validation of Methods for Detection, Identification, and Quantification of Specific DNA Sequences and Specific Proteins In Foods.
Himawati, A., 2013, Analisis Campuran Daging Babi dan Sapi dalam Bakso dengan Metode Spektrofotometri Fourier Transform Infrared dan Real-Time Polymerase Chain Reaction. Universitas Gadjah Mada, Yogyakarta.
Iwobi, I.H., and Ulrich, B., 2012, The Application of PCR-Based Methods in Food Control Agencies – A Review, Dr. Patricia Hernandez-Rodriguez (Ed.), Polymerase Chain Reaction. InTech, 566.
Life Technologies, 2012, Real-Time PCR Handbook -Gene Quantification. Life Technologies Corporation.
Martin, M., GarcÃa, T., Violeta, F., MarÃa, R., Nicolette, P., Hernández, P.E., et al., 2009, SYBR-Green real-time PCR approach for the detection and quantification of pig DNA in feedstuffs. Meat Science, 82: 252 – 259.
McPherson and Simon., 2006, PCR, second. Ed. Taylor and Francis Group.
Mohamad, N.A., El Sheikha, A.F., Mustafa, S., and Mokhtar, N.F.K., 2013, Comparison of gene nature used in real-time PCR for porcine identification and quantification: A review. Food Research International, 50: 330–338.
Muhammed, M.A., Bindu, B.S.C., Jini, R., Prashanth, K.V.H., and Bhaskar, N., 2015, Evaluation of different DNA extraction methods for the detection of adulteration in raw and processed meat through polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). Journal of Food Science Technology, 52: 514 – 520.
Muladno, 2010. Teknologi Rekayasa Genetika. IPB Press, Bogor.
Nuraini, H., A. Primasari, E. Andreas, and C. Sumantri., 2012, The Use of Cytochrome b Gene as a Specific Marker of the Rat Meat (Rattus norvegicus) on Meat and Meat Products. Media Peternakan, 15 – 20.
Olson, N. D., and Morrow, J. B., 2012, DNA extract characterization process for microbial detection methods development and validation, BMC Research Notes, 5, 668.
Rahman, M.M., Ali, M.E., Hamid, S.B.A., Mustafa, S., Hashim, U., and Hanapi, U.K., 2014, Polymerase chain reaction assay targeting cytochrome b gene for the detection of dog meat adulteration in meatball formulation. Meat Science, 97: 404 – 409.
Sambrook, J., Fritsch, E. F., and Maniatis, T. A., 1989, Molecular Cloning: A Laboratory Manual. 2nd, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, USA., 397.
Soares, S., Amaral, J.S., Oliveira, M.B.P.P., and Mafra, I., 2013, An SYBR Green real-time PCR assay to detect and quantify pork meat in processed poultry meat products. Meat Science, 94: 115 – 120.
Sudjadi., 2008, Bioteknologi Kesehatan. Kanisius, Yogyakarta.
Svec, D., A. Tichopad, V. Novosadova, M.W. Pfaffl and M. Kubista., 2015, How good is a PCR efficiency estimate: Recommendations for precise and robust qPCR efficiency assessments. Biomol. Detection Quantification, 3: 9-16.
Taufiq, R., 2014, Analisis Kontaminasi DNA Babi pada Abon dengan Primer Mitokondria D-Loop22 menggunakan Metode Real-Time Polymerase Chain Reaction. Universitas Gadjah Mada, Yogyakarta.
Yuan, J.S., Reed, A., Chen, F., and C Neal Stewart Jr, 2006, Statistical analysis of real-time PCR data. BMC Bioinformatics, 7: Bio-Rad, 2006. Real-Time PCR Application Guide. Bio-Rad Laboratories, Inc, USA.
Downloads
Published
Issue
Section
License
Authors who publish with Pharmaciana agree to the following terms:
- Authors retain copyright and grant the journal the right of first publication with the work simultaneously licensed under a Creative Commons Attribution License (CC BY-SA 4.0) that allows others to share the work with an acknowledgment of the work's authorship and initial publication in this journal.
- Authors are able to enter into separate, additional contractual arrangements for the non-exclusive distribution of the journal's published version of the work (e.g., post it to an institutional repository or publish it in a book), with an acknowledgment of its initial publication in this journal.
- Authors are permitted and encouraged to post their work online (e.g., in institutional repositories or on their website) prior to and during the submission process, as it can lead to productive exchanges, as well as earlier and greater citation of published work.
1.png)
